resolves bebop#352 remove error from Feature.GetSequence() as it has …

…nothing to return

io/genbank/example_test.go

@@ -131,7 +131,7 @@ func ExampleGenbank_AddFeature() {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	fmt.Println(gfpSequence == featureSequence)
@@ -159,7 +159,7 @@ func ExampleFeature_GetSequence() {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	fmt.Println(gfpSequence == featureSequence)

io/genbank/genbank.go

@@ -126,12 +126,12 @@ func (sequence *Genbank) AddFeature(feature *Feature) error {
 }
 
 // GetSequence returns the sequence of a feature.
-func (feature Feature) GetSequence() (string, error) {
+func (feature Feature) GetSequence() string {
 	return getFeatureSequence(feature, feature.Location)
 }
 
 // getFeatureSequence takes a feature and location object and returns a sequence string.
-func getFeatureSequence(feature Feature, location Location) (string, error) {
+func getFeatureSequence(feature Feature, location Location) string {
 	var sequenceBuffer bytes.Buffer
 	var sequenceString string
 	parentSequence := feature.ParentSequence.Sequence
@@ -140,7 +140,7 @@ func getFeatureSequence(feature Feature, location Location) (string, error) {
 		sequenceBuffer.WriteString(parentSequence[location.Start:location.End])
 	} else {
 		for _, subLocation := range location.SubLocations {
-			sequence, _ := getFeatureSequence(feature, subLocation)
+			sequence := getFeatureSequence(feature, subLocation)
 
 			sequenceBuffer.WriteString(sequence)
 		}
@@ -153,7 +153,7 @@ func getFeatureSequence(feature Feature, location Location) (string, error) {
 		sequenceString = sequenceBuffer.String()
 	}
 
-	return sequenceString, nil
+	return sequenceString
 }
 
 // Read reads a GBK file from path and returns a Genbank struct.

io/genbank/genbank_test.go

@@ -172,7 +172,7 @@ func TestGetSequenceMethod(t *testing.T) {
 	gbk, _ := Read("../../data/t4_intron.gb")
 
 	// Check to see if GetSequence method works on Features struct
-	feature, _ := gbk.Features[1].GetSequence()
+	feature := gbk.Features[1].GetSequence()
 	seq := "atgagattacaacgccagagcatcaaagattcagaagttagaggtaaatggtattttaatatcatcggtaaagattctgaacttgttgaaaaagctgaacatcttttacgtgatatgggatgggaagatgaatgcgatggatgtcctctttatgaagacggagaaagcgcaggattttggatttaccattctgacgtcgagcagtttaaagctgattggaaaattgtgaaaaagtctgtttga"
 	if feature != seq {
 		t.Errorf("Feature GetSequence method has failed. Got this:\n%s instead of \n%s", feature, seq)
@@ -183,21 +183,21 @@ func TestLocationParser(t *testing.T) {
 	gbk, _ := Read("../../data/t4_intron.gb")
 
 	// Read 1..243
-	feature, _ := gbk.Features[1].GetSequence()
+	feature := gbk.Features[1].GetSequence()
 	seq := "atgagattacaacgccagagcatcaaagattcagaagttagaggtaaatggtattttaatatcatcggtaaagattctgaacttgttgaaaaagctgaacatcttttacgtgatatgggatgggaagatgaatgcgatggatgtcctctttatgaagacggagaaagcgcaggattttggatttaccattctgacgtcgagcagtttaaagctgattggaaaattgtgaaaaagtctgtttga"
 	if feature != seq {
 		t.Errorf("Feature sequence parser has changed on test '1..243'. Got this:\n%s instead of \n%s", feature, seq)
 	}
 
 	// Read join(893..1441,2459..2770)
-	featureJoin, _ := gbk.Features[6].GetSequence()
+	featureJoin := gbk.Features[6].GetSequence()
 	seqJoin := "atgaaacaataccaagatttaattaaagacatttttgaaaatggttatgaaaccgatgatcgtacaggcacaggaacaattgctctgttcggatctaaattacgctgggatttaactaaaggttttcctgcggtaacaactaagaagctcgcctggaaagcttgcattgctgagctaatatggtttttatcaggaagcacaaatgtcaatgatttacgattaattcaacacgattcgttaatccaaggcaaaacagtctgggatgaaaattacgaaaatcaagcaaaagatttaggataccatagcggtgaacttggtccaatttatggaaaacagtggcgtgattttggtggtgtagaccaaattatagaagttattgatcgtattaaaaaactgccaaatgataggcgtcaaattgtttctgcatggaatccagctgaacttaaatatatggcattaccgccttgtcatatgttctatcagtttaatgtgcgtaatggctatttggatttgcagtggtatcaacgctcagtagatgttttcttgggtctaccgtttaatattgcgtcatatgctacgttagttcatattgtagctaagatgtgtaatcttattccaggggatttgatattttctggtggtaatactcatatctatatgaatcacgtagaacaatgtaaagaaattttgaggcgtgaacctaaagagctttgtgagctggtaataagtggtctaccttataaattccgatatctttctactaaagaacaattaaaatatgttcttaaacttaggcctaaagatttcgttcttaacaactatgtatcacaccctcctattaaaggaaagatggcggtgtaa"
 	if featureJoin != seqJoin {
 		t.Errorf("Feature sequence parser has changed on test 'join(893..1441,2459..2770)'. Got this:\n%s instead of \n%s", featureJoin, seqJoin)
 	}
 
 	// Read complement(2791..3054)
-	featureComplement, _ := gbk.Features[10].GetSequence()
+	featureComplement := gbk.Features[10].GetSequence()
 	seqComplement := "ttattcactacccggcatagacggcccacgctggaataattcgtcatattgtttttccgttaaaacagtaatatcgtagtaacagtcagaagaagttttaactgtggaaattttattatcaaaatactcacgagtcattttatgagtatagtattttttaccataaatggtaataggctgttctggtcctggaacttctaactcgcttgggttaggaagtgtaaaaagaactacaccagaagtatctttaaatcgtaaaatcat"
 	if featureComplement != seqComplement {
 		t.Errorf("Feature sequence parser has changed on test 'complement(2791..3054)'. Got this:\n%s instead of \n%s", featureComplement, seqComplement)
@@ -208,14 +208,14 @@ func TestLocationParser(t *testing.T) {
 	// that the first sequence should be appended to the reverse sequence, instead of the second sequence
 	// getting appended to the first. Biopython appends the second sequence to the first, and that is logically
 	// the most obvious thing to do, so we are implementing it that way.
-	featureJoinComplement, _ := gbk.Features[3].GetSequence()
+	featureJoinComplement := gbk.Features[3].GetSequence()
 	seqJoinComplement := "ataccaatttaatcattcatttatatactgattccgtaagggttgttacttcatctattttataccaatgcgtttcaaccatttcacgcttgcttatatcatcaagaaaacttgcgtctaattgaactgttgaattaacacgatgccttttaacgatgcgagaaacaactacttcatctgcataaggtaatgcagcatataacagagcaggcccgccaattacacttactttagaattctgatcaagcatagtttcgaatggtgcattagggcttgacacttgaatttcgccgccagaaatgtaagttatatattgctcccaagtaatatagaaatgtgctaaatcgccgtctttagttacaggataatcacgcgcaaggtcacacaccacaatatggctacgaccaggaagtaatgtaggcaatgactggaacgttttagcacccataatcataattgtgccttcagtacgagctttaaaattctggaggtcctttttaactcgtccccatggtaaaccatcacctaaaccgaatgctaattcattaaagccgtcgaccgttttagttggaga"
 	if featureJoinComplement != seqJoinComplement {
 		t.Errorf("Feature sequence parser has changed on test 'join(complement(315..330),complement(339..896))'. Got this:\n%s instead of \n%s", featureJoinComplement, seqJoinComplement)
 	}
 
 	// Read complement(join(893..1098,1101..2770))
-	featureComplementJoin, _ := gbk.Features[5].GetSequence()
+	featureComplementJoin := gbk.Features[5].GetSequence()
 	seqComplementJoin := "ttacaccgccatctttcctttaataggagggtgtgatacatagttgttaagaacgaaatctttaggcctaagtttaagaacatattttaattgttctttagtagaaagatatcggaatttataaggtagaccacttattaccagctcacaaagctctttaggttcacgcctcaaaatttctttacattgttctacgtgattcatatagatatgagtattaccaccagaaaatatcaaatcccctggaataagattacacatcttagctacaatatgaactaacgtagcatatgacgcaatattaaacggtagcattatgttcagataaggtcgttaatcttaccccggaattatatccagctgcatgtcaccatgcagagcagactatatctccaacttgttaaagcaagttgtctatcgtttcgagtcacttgaccctactccccaaagggatagtcgttaggcatttatgtagaaccaattccatttatcagattttacacgataagtaactaatccagacgaaattttaaaatgtctagctgcatctgctgcacaatcaaaaataaccccatcacatgaaatctttttaatattactaggctttttacctttcatcttttctgatattttagatttagttatgtctgaatgcttatgattaaagaatgaattattttcacctgaacgatttctgcatttactacaagtataagcagaagtttgtatgcgaacaccgcacttacaaaacttatgggtttctggattccaacgcccgtttttacttccgggtttactgtaaagagctttccgaccatcaggtccaagtttaagcatcttagctttaacagtttcagaacgtttcttaataatttcttcttttaatggatgcgtagaacatgtatcaccaaacgttgcatcagcaatattgtatccattaattttagaattaagctctttaatccaaaaattttctcgttcaataatcaaatctttctcatatggaatttcttccaaaatagaacattcaaacacattaccatgtttgttaaaagacctctgaagttttatagaagaatggcatcctttttctaaatctttaaaatgcctcttccatctcttttcaaaatctttagcacttcctacatatactttattgtttaaagtatttttaatctgataaattccgcttttcataaatacctctttaaatatagaagtatttattaaagggcaagtcctacaatttagcacgggattgtctactagagaggttccccgtttagatagattacaagtataagtcaccttatactcaggcctcaattaacccaagaaaacatctactgagcgttgataccactgcaaatccaaatagccattacgcacattaaactgatagaacatatgacaaggcggtaatgccatatatttaagttcagctggattccatgcagaaacaatttgacgcctatcatttggcagttttttaatacgatcaataacttctataatttggtctacaccaccaaaatcacgccactgttttccataaattggaccaagttcaccgctatggtatcctaaatcttttgcttgattttcgtaattttcatcccagactgttttgccttggattaacgaatcgtgttgaattaatcgtaaatcatacatttgtgcttcctgataaaaaccatattagctcagcaatgcaagctttccaggcgagcttcttagttgttaccgcaggaaaacctttagttaaatcccagcgtaatttagatccgaacagagcaattgttcctgtgcctgtacgatcatcggtttcataaccattttcaaaaatgtctttaattaaatcttggtattgtttcat"
 	if featureComplementJoin != seqComplementJoin {
 		t.Errorf("Feature sequence parser has changed on test 'complement(join(893..1098,1101..2770))'. Got this:\n%s instead of \n%s", featureComplementJoin, seqComplementJoin)
@@ -363,7 +363,7 @@ func TestFeature_GetSequence_Legacy(t *testing.T) {
 	_ = sequence.AddFeature(&feature)
 
 	// get the GFP feature sequence string from the sequence struct.
-	featureSequence, _ := feature.GetSequence()
+	featureSequence := feature.GetSequence()
 
 	// check to see if the feature was inserted properly into the sequence.
 	if gfpSequence != featureSequence {

synthesis/codon/codon_test.go

@@ -86,7 +86,7 @@ func TestOptimize(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -116,7 +116,7 @@ func TestOptimizeSameSeed(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -146,7 +146,7 @@ func TestOptimizeDifferentSeed(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -302,7 +302,7 @@ func TestCompromiseCodonTable(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -322,7 +322,7 @@ func TestCompromiseCodonTable(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence2.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder2.WriteString(sequence)
 		}
 	}
@@ -370,7 +370,7 @@ func TestCapitalizationRegression(t *testing.T) {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}

synthesis/codon/example_test.go

@@ -32,7 +32,7 @@ func ExampleOptimize() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			// Note: sometimes, genbank files will have annotated CDSs that are pseudo genes (not having triplet codons).
 			// This will shift the entire codon table, messing up the end results. To fix this, make sure to do a modulo
 			// check.
@@ -108,7 +108,7 @@ func ExampleCompromiseCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -127,7 +127,7 @@ func ExampleCompromiseCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence2.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder2.WriteString(sequence)
 		}
 	}
@@ -159,7 +159,7 @@ func ExampleAddCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder.WriteString(sequence)
 		}
 	}
@@ -179,7 +179,7 @@ func ExampleAddCodonTable() {
 	// iterate through the features of the genbank file and if the feature is a coding region, append the sequence to the string builder
 	for _, feature := range sequence2.Features {
 		if feature.Type == "CDS" {
-			sequence, _ := feature.GetSequence()
+			sequence := feature.GetSequence()
 			codingRegionsBuilder2.WriteString(sequence)
 		}
 	}

tutorials/001_input_output_test.go

@@ -114,7 +114,7 @@ func TestFileIOTutorial(t *testing.T) {
 	// get the sequence of each feature using the GetSequence method.
 
 	feature := puc19.Features[1]
-	featureSequence, _ := feature.GetSequence()       // this is the sequence of the feature
+	featureSequence := feature.GetSequence()          // this is the sequence of the feature
 	expectedFeatureSequence := "gggaaacgcctggtatcttt" // this is what we expect the sequence of the feature to be
 	if featureSequence != expectedFeatureSequence {
 		t.Errorf("Expected feature sequence to be %s but got %s", expectedFeatureSequence, featureSequence)