diff --git a/packages/apollo-mst/src/AnnotationFeatureModel.ts b/packages/apollo-mst/src/AnnotationFeatureModel.ts
index dc093d34f..cf5b07cff 100644
--- a/packages/apollo-mst/src/AnnotationFeatureModel.ts
+++ b/packages/apollo-mst/src/AnnotationFeatureModel.ts
@@ -1,4 +1,4 @@
-import { intersection2 } from '@jbrowse/core/util'
+import { getSession, intersection2 } from '@jbrowse/core/util'
 import {
   IAnyModelType,
   IMSTMap,
@@ -109,7 +109,14 @@ export const AnnotationFeatureModel = types
       return false
     },
     get cdsLocations(): { min: number; max: number; phase: 0 | 1 | 2 }[][] {
-      if (self.type !== 'mRNA') {
+      // eslint-disable-next-line @typescript-eslint/no-unsafe-assignment, @typescript-eslint/no-explicit-any
+      const session = getSession(self) as any
+      // eslint-disable-next-line @typescript-eslint/no-unsafe-assignment
+      const { apolloDataStore } = session
+      // eslint-disable-next-line @typescript-eslint/no-unsafe-assignment, @typescript-eslint/no-unsafe-member-access
+      const { featureTypeOntology } = apolloDataStore.ontologyManager
+      // eslint-disable-next-line @typescript-eslint/no-unsafe-call, @typescript-eslint/no-unsafe-member-access
+      if (!featureTypeOntology.isTypeOf(self.type, 'mRNA')) {
         throw new Error(
           'Only features of type "mRNA" or equivalent can calculate CDS locations',
         )
@@ -119,7 +126,8 @@ export const AnnotationFeatureModel = types
         throw new Error('no CDS or exons in mRNA')
       }
       const cdsChildren = [...children.values()].filter(
-        (child) => child.type === 'CDS',
+        // eslint-disable-next-line @typescript-eslint/no-unsafe-call, @typescript-eslint/no-unsafe-member-access
+        (child) => featureTypeOntology.isTypeOf(child.type, 'CDS'),
       )
       if (cdsChildren.length === 0) {
         throw new Error('no CDS in mRNA')
@@ -130,7 +138,8 @@ export const AnnotationFeatureModel = types
         const { max: cdsMax, min: cdsMin } = cds
         const locs: { min: number; max: number }[] = []
         for (const [, child] of children) {
-          if (child.type !== 'exon') {
+          // eslint-disable-next-line @typescript-eslint/no-unsafe-call, @typescript-eslint/no-unsafe-member-access
+          if (!featureTypeOntology.isTypeOf(child.type, 'exon')) {
             continue
           }
           const [start, end] = intersection2(
diff --git a/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptBasic.tsx b/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptBasic.tsx
index acc7db878..9b25f310a 100644
--- a/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptBasic.tsx
+++ b/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptBasic.tsx
@@ -83,8 +83,11 @@ export const TranscriptBasicInformation = observer(
     const { notify } = session as unknown as AbstractSessionModel
     const currentAssembly = session.apolloDataStore.assemblies.get(assembly)
     const refData = currentAssembly?.getByRefName(refName)
-    const { changeManager } = session.apolloDataStore
-
+    const { changeManager, ontologyManager } = session.apolloDataStore
+    const { featureTypeOntology } = ontologyManager
+    if (!featureTypeOntology) {
+      throw new Error('featureTypeOntology is undefined')
+    }
     function handleStartChange(
       newStart: number,
       featureId: string,
@@ -100,10 +103,14 @@ export const TranscriptBasicInformation = observer(
       if (!subFeature?.children) {
         return
       }
+      if (!featureTypeOntology) {
+        throw new Error('featureTypeOntology is undefined')
+      }
       // Let's check CDS start and end values. And possibly update those too
       for (const child of subFeature.children) {
         if (
-          (child[1].type === 'CDS' || child[1].type === 'exon') &&
+          (featureTypeOntology.isTypeOf(child[1].type, 'CDS') ||
+            featureTypeOntology.isTypeOf(child[1].type, 'exon')) &&
           child[1].min === oldStart
         ) {
           const change = new LocationStartChange({
@@ -135,10 +142,14 @@ export const TranscriptBasicInformation = observer(
       if (!subFeature?.children) {
         return
       }
+      if (!featureTypeOntology) {
+        throw new Error('featureTypeOntology is undefined')
+      }
       // Let's check CDS start and end values. And possibly update those too
       for (const child of subFeature.children) {
         if (
-          (child[1].type === 'CDS' || child[1].type === 'exon') &&
+          (featureTypeOntology.isTypeOf(child[1].type, 'CDS') ||
+            featureTypeOntology.isTypeOf(child[1].type, 'exon')) &&
           child[1].max === oldEnd
         ) {
           const change = new LocationEndChange({
@@ -160,7 +171,7 @@ export const TranscriptBasicInformation = observer(
     const featureNew = feature
     let exonsArray: ExonInfo[] = []
     const traverse = (currentFeature: AnnotationFeature) => {
-      if (currentFeature.type === 'exon') {
+      if (featureTypeOntology.isTypeOf(currentFeature.type, 'exon')) {
         exonsArray.push({
           min: currentFeature.min + 1,
           max: currentFeature.max,
@@ -384,10 +395,10 @@ export const TranscriptBasicInformation = observer(
           {transcriptItems.map((item, index) => (
             <div key={index} style={{ display: 'flex', alignItems: 'center' }}>
               <span style={{ marginLeft: '20px', width: '50px' }}>
-                {item.type === 'three_prime_UTR'
+                {featureTypeOntology.isTypeOf(item.type, 'three_prime_UTR')
                   ? '3 UTR'
                   : // eslint-disable-next-line unicorn/no-nested-ternary
-                    item.type === 'five_prime_UTR'
+                    featureTypeOntology.isTypeOf(item.type, 'five_prime_UTR')
                     ? '5 UTR'
                     : 'CDS'}
               </span>
@@ -397,7 +408,7 @@ export const TranscriptBasicInformation = observer(
               <NumberTextField
                 margin="dense"
                 id={item.id}
-                disabled={item.type !== 'CDS'}
+                disabled={!featureTypeOntology.isTypeOf(item.type, 'CDS')}
                 style={{
                   width: '150px',
                   marginLeft: '8px',
@@ -419,7 +430,7 @@ export const TranscriptBasicInformation = observer(
               <NumberTextField
                 margin="dense"
                 id={item.id}
-                disabled={item.type !== 'CDS'}
+                disabled={!featureTypeOntology.isTypeOf(item.type, 'CDS')}
                 style={{
                   width: '150px',
                   backgroundColor:
diff --git a/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptSequence.tsx b/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptSequence.tsx
index 4497be0da..ac8910eb3 100644
--- a/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptSequence.tsx
+++ b/packages/jbrowse-plugin-apollo/src/FeatureDetailsWidget/TranscriptSequence.tsx
@@ -12,6 +12,7 @@ import { observer } from 'mobx-react'
 import React, { useState } from 'react'
 
 import { ApolloSessionModel } from '../session'
+import { OntologyRecord } from '../OntologyManager'
 
 export interface CDSInfo {
   id: string
@@ -28,6 +29,7 @@ export interface CDSInfo {
 const getCDSInfo = (
   feature: AnnotationFeature,
   refData: ApolloRefSeqI,
+  featureTypeOntology: OntologyRecord,
 ): CDSInfo[] => {
   const CDSresult: CDSInfo[] = []
   const traverse = (
@@ -36,9 +38,9 @@ const getCDSInfo = (
   ) => {
     if (
       isParentMRNA &&
-      (currentFeature.type === 'CDS' ||
-        currentFeature.type === 'three_prime_UTR' ||
-        currentFeature.type === 'five_prime_UTR')
+      (featureTypeOntology.isTypeOf(currentFeature.type, 'CDS') ||
+        featureTypeOntology.isTypeOf(currentFeature.type, 'three_prime_UTR') ||
+        featureTypeOntology.isTypeOf(currentFeature.type, 'five_prime_UTR'))
     ) {
       let startSeq = refData.getSequence(
         Number(currentFeature.min) - 2,
@@ -149,14 +151,22 @@ export const TranscriptSequence = observer(function TranscriptSequence({
   if (!refSeq) {
     return null
   }
-  const transcriptItems = getCDSInfo(feature, refData)
+  const { featureTypeOntology } = session.apolloDataStore.ontologyManager
+  if (!featureTypeOntology) {
+    throw new Error('featureTypeOntology is undefined')
+  }
+  const transcriptItems = getCDSInfo(feature, refData, featureTypeOntology)
   const { max, min } = feature
   let sequence = ''
   if (showSequence) {
-    getSequenceAsString(min, max)
+    getSequenceAsString(min, max, featureTypeOntology)
   }
 
-  function getSequenceAsString(start: number, end: number): string {
+  function getSequenceAsString(
+    start: number,
+    end: number,
+    featureTypeOntology: OntologyRecord,
+  ): string {
     sequence = refSeq?.getSequence(start, end) ?? ''
     if (sequence === '') {
       void session.apolloDataStore.loadRefSeq([
@@ -165,7 +175,7 @@ export const TranscriptSequence = observer(function TranscriptSequence({
     } else {
       sequence = formatSequence(sequence, refName, start, end)
     }
-    getSequenceAsTextSegment(selectedOption) // For color coded sequence
+    getSequenceAsTextSegment(selectedOption, featureTypeOntology) // For color coded sequence
     return sequence
   }
 
@@ -173,7 +183,10 @@ export const TranscriptSequence = observer(function TranscriptSequence({
     setShowSequence(!showSequence)
   }
 
-  function getSequenceAsTextSegment(option: string) {
+  function getSequenceAsTextSegment(
+    option: string,
+    featureTypeOntology: OntologyRecord,
+  ) {
     let seqData = ''
     textSegments = []
     if (!refData) {
@@ -183,7 +196,7 @@ export const TranscriptSequence = observer(function TranscriptSequence({
       case 'CDS': {
         textSegments.push({ text: `>${refName} : CDS\n`, color: 'black' })
         for (const item of transcriptItems) {
-          if (item.type === 'CDS') {
+          if (featureTypeOntology.isTypeOf(item.type, 'CDS')) {
             const refSeq: string = refData.getSequence(
               Number(item.min + 1),
               Number(item.max),
@@ -198,16 +211,16 @@ export const TranscriptSequence = observer(function TranscriptSequence({
         textSegments.push({ text: `>${refName} : cDNA\n`, color: 'black' })
         for (const item of transcriptItems) {
           if (
-            item.type === 'CDS' ||
-            item.type === 'three_prime_UTR' ||
-            item.type === 'five_prime_UTR'
+            featureTypeOntology.isTypeOf(item.type, 'CDS') ||
+            featureTypeOntology.isTypeOf(item.type, 'three_prime_UTR') ||
+            featureTypeOntology.isTypeOf(item.type, 'five_prime_UTR')
           ) {
             const refSeq: string = refData.getSequence(
               Number(item.min + 1),
               Number(item.max),
             )
             seqData += item.strand === -1 && refSeq ? revcom(refSeq) : refSeq
-            if (item.type === 'CDS') {
+            if (featureTypeOntology.isTypeOf(item.type, 'CDS')) {
               textSegments.push({ text: seqData, color: cdsColor })
             } else {
               textSegments.push({ text: seqData, color: utrColor })
@@ -239,9 +252,9 @@ export const TranscriptSequence = observer(function TranscriptSequence({
             textSegments.push({ text: seqData, color: 'black' })
           }
           if (
-            item.type === 'CDS' ||
-            item.type === 'three_prime_UTR' ||
-            item.type === 'five_prime_UTR'
+            featureTypeOntology.isTypeOf(item.type, 'CDS') ||
+            featureTypeOntology.isTypeOf(item.type, 'three_prime_UTR') ||
+            featureTypeOntology.isTypeOf(item.type, 'five_prime_UTR')
           ) {
             const refSeq: string = refData.getSequence(
               Number(item.min + 1),
@@ -274,10 +287,13 @@ export const TranscriptSequence = observer(function TranscriptSequence({
     }
   }
 
-  function handleChangeSeqOption(e: SelectChangeEvent) {
+  function handleChangeSeqOption(
+    e: SelectChangeEvent,
+    featureTypeOntology: OntologyRecord,
+  ) {
     const option = e.target.value
     setSelectedOption(option)
-    getSequenceAsTextSegment(option)
+    getSequenceAsTextSegment(option, featureTypeOntology)
   }
 
   // Function to copy text to clipboard
@@ -329,7 +345,9 @@ export const TranscriptSequence = observer(function TranscriptSequence({
         {showSequence && (
           <Select
             value={selectedOption}
-            onChange={handleChangeSeqOption}
+            onChange={(e: SelectChangeEvent) => {
+              handleChangeSeqOption(e, featureTypeOntology)
+            }}
             style={{ width: '150px', marginLeft: '15px', height: '25px' }}
           >
             <MenuItem value={'Select'}>Select</MenuItem>
diff --git a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/GeneGlyph.ts b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/GeneGlyph.ts
index f8e01be7c..e35e991ff 100644
--- a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/GeneGlyph.ts
+++ b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/GeneGlyph.ts
@@ -12,6 +12,7 @@ import { CanvasMouseEvent } from '../types'
 import { Glyph } from './Glyph'
 import { boxGlyph } from './BoxGlyph'
 import { LinearApolloDisplayRendering } from '../stateModel/rendering'
+import { OntologyRecord } from '../../OntologyManager'
 
 let forwardFillLight: CanvasPattern | null = null
 let backwardFillLight: CanvasPattern | null = null
@@ -80,6 +81,11 @@ function draw(
     return
   }
   const { apolloSelectedFeature } = session
+  const { apolloDataStore } = session
+  const { featureTypeOntology } = apolloDataStore.ontologyManager
+  if (!featureTypeOntology) {
+    throw new Error('featureTypeOntology is undefined')
+  }
 
   // Draw background for gene
   const topLevelFeatureMinX =
@@ -93,7 +99,8 @@ function draw(
     ? topLevelFeatureMinX - topLevelFeatureWidthPx
     : topLevelFeatureMinX
   const topLevelFeatureTop = row * rowHeight
-  const topLevelFeatureHeight = getRowCount(feature) * rowHeight
+  const topLevelFeatureHeight =
+    getRowCount(feature, featureTypeOntology) * rowHeight
 
   ctx.fillStyle = alpha(theme?.palette.background.paper ?? '#ffffff', 0.6)
   ctx.fillRect(
@@ -106,7 +113,8 @@ function draw(
   // Draw lines on different rows for each mRNA
   let currentRow = 0
   for (const [, mrna] of children) {
-    if (mrna.type !== 'mRNA') {
+    const isMrna = featureTypeOntology.isTypeOf(mrna.type, 'mRNA')
+    if (!isMrna) {
       currentRow += 1
       continue
     }
@@ -115,7 +123,7 @@ function draw(
       continue
     }
     for (const [, cds] of childrenOfmRNA) {
-      if (cds.type !== 'CDS') {
+      if (!featureTypeOntology.isTypeOf(cds.type, 'CDS')) {
         continue
       }
       const minX =
@@ -144,7 +152,7 @@ function draw(
   // Draw exon and CDS for each mRNA
   currentRow = 0
   for (const [, child] of children) {
-    if (child.type !== 'mRNA') {
+    if (!featureTypeOntology.isTypeOf(child.type, 'mRNA')) {
       boxGlyph.draw(ctx, child, row, stateModel, displayedRegionIndex)
       currentRow += 1
       continue
@@ -155,7 +163,7 @@ function draw(
         continue
       }
       for (const [, exon] of childrenOfmRNA) {
-        if (exon.type !== 'exon') {
+        if (!featureTypeOntology.isTypeOf(exon.type, 'exon')) {
           continue
         }
         const minX =
@@ -296,7 +304,9 @@ function drawHover(
   stateModel: LinearApolloDisplay,
   ctx: CanvasRenderingContext2D,
 ) {
-  const { apolloHover, apolloRowHeight, lgv, theme } = stateModel
+  const { apolloHover, apolloRowHeight, lgv, session, theme } = stateModel
+  const { featureTypeOntology } = session.apolloDataStore.ontologyManager
+
   if (!apolloHover) {
     return
   }
@@ -320,16 +330,26 @@ function drawHover(
   const top = row * apolloRowHeight
   const widthPx = length / bpPerPx
   ctx.fillStyle = theme?.palette.action.selected ?? 'rgba(0,0,0,04)'
-  ctx.fillRect(startPx, top, widthPx, apolloRowHeight * getRowCount(feature))
+
+  if (!featureTypeOntology) {
+    throw new Error('featureTypeOntology is undefined')
+  }
+  ctx.fillRect(
+    startPx,
+    top,
+    widthPx,
+    apolloRowHeight * getRowCount(feature, featureTypeOntology),
+  )
 }
 
 function getFeatureFromLayout(
   feature: AnnotationFeature,
   bp: number,
   row: number,
+  featureTypeOntology: OntologyRecord,
 ): AnnotationFeature | undefined {
   const featureInThisRow: AnnotationFeature[] =
-    featuresForRow(feature)[row] || []
+    featuresForRow(feature, featureTypeOntology)[row] || []
   for (const f of featureInThisRow) {
     let featureObj
     if (bp >= f.min && bp <= f.max && f.parent) {
@@ -339,9 +359,9 @@ function getFeatureFromLayout(
       continue
     }
     if (
-      featureObj.type === 'CDS' &&
+      featureTypeOntology.isTypeOf(featureObj.type, 'CDS') &&
       featureObj.parent &&
-      featureObj.parent.type === 'mRNA'
+      featureTypeOntology.isTypeOf(featureObj.parent.type, 'mRNA')
     ) {
       const { cdsLocations } = featureObj.parent
       for (const cdsLoc of cdsLocations) {
@@ -361,22 +381,28 @@ function getFeatureFromLayout(
   return feature
 }
 
-function getRowCount(feature: AnnotationFeature, _bpPerPx?: number): number {
+function getRowCount(
+  feature: AnnotationFeature,
+  featureTypeOntology: OntologyRecord,
+  _bpPerPx?: number,
+): number {
   const { children, type } = feature
   if (!children) {
     return 1
   }
+  const isMrna = featureTypeOntology.isTypeOf(type, 'mRNA')
   let rowCount = 0
-  if (type === 'mRNA') {
+  if (isMrna) {
     for (const [, child] of children) {
-      if (child.type === 'CDS') {
+      const isCds = featureTypeOntology.isTypeOf(child.type, 'CDS')
+      if (isCds) {
         rowCount += 1
       }
     }
     return rowCount
   }
   for (const [, child] of children) {
-    rowCount += getRowCount(child)
+    rowCount += getRowCount(child, featureTypeOntology)
   }
   return rowCount
 }
@@ -387,8 +413,12 @@ function getRowCount(feature: AnnotationFeature, _bpPerPx?: number): number {
  * If the row contains an mRNA, the order is CDS -\> exon -\> mRNA -\> gene
  * If the row does not contain an mRNA, the order is subfeature -\> gene
  */
-function featuresForRow(feature: AnnotationFeature): AnnotationFeature[][] {
-  if (feature.type !== 'gene') {
+function featuresForRow(
+  feature: AnnotationFeature,
+  featureTypeOntology: OntologyRecord,
+): AnnotationFeature[][] {
+  const isGene = featureTypeOntology.isTypeOf(feature.type, 'gene')
+  if (!isGene) {
     throw new Error('Top level feature for GeneGlyph must have type "gene"')
   }
   const { children } = feature
@@ -397,7 +427,7 @@ function featuresForRow(feature: AnnotationFeature): AnnotationFeature[][] {
   }
   const features: AnnotationFeature[][] = []
   for (const [, child] of children) {
-    if (child.type !== 'mRNA') {
+    if (!featureTypeOntology.isTypeOf(child.type, 'mRNA')) {
       features.push([child, feature])
       continue
     }
@@ -407,9 +437,9 @@ function featuresForRow(feature: AnnotationFeature): AnnotationFeature[][] {
     const cdss: AnnotationFeature[] = []
     const exons: AnnotationFeature[] = []
     for (const [, grandchild] of child.children) {
-      if (grandchild.type === 'CDS') {
+      if (featureTypeOntology.isTypeOf(grandchild.type, 'CDS')) {
         cdss.push(grandchild)
-      } else if (grandchild.type === 'exon') {
+      } else if (featureTypeOntology.isTypeOf(grandchild.type, 'exon')) {
         exons.push(grandchild)
       }
     }
@@ -423,8 +453,9 @@ function featuresForRow(feature: AnnotationFeature): AnnotationFeature[][] {
 function getRowForFeature(
   feature: AnnotationFeature,
   childFeature: AnnotationFeature,
+  featureTypeOntology: OntologyRecord,
 ) {
-  const rows = featuresForRow(feature)
+  const rows = featuresForRow(feature, featureTypeOntology)
   for (const [idx, row] of rows.entries()) {
     if (row.some((feature) => feature._id === childFeature._id)) {
       return idx
@@ -496,7 +527,16 @@ function getDraggableFeatureInfo(
   feature: AnnotationFeature,
   stateModel: LinearApolloDisplay,
 ): { feature: AnnotationFeature; edge: 'min' | 'max' } | undefined {
-  if (feature.type === 'gene' || feature.type === 'mRNA') {
+  const { session } = stateModel
+  const { apolloDataStore } = session
+  const { featureTypeOntology } = apolloDataStore.ontologyManager
+  if (!featureTypeOntology) {
+    throw new Error('featureTypeOntology is undefined')
+  }
+  const isGene = featureTypeOntology.isTypeOf(feature.type, 'gene')
+  const isMrna = featureTypeOntology.isTypeOf(feature.type, 'mRNA')
+  const isCds = featureTypeOntology.isTypeOf(feature.type, 'CDS')
+  if (isGene || isMrna) {
     return
   }
   const { bp, refName, regionNumber, x } = mousePosition
@@ -519,14 +559,19 @@ function getDraggableFeatureInfo(
   if (Math.abs(maxPx - x) < 4) {
     return { feature, edge: 'max' }
   }
-  if (feature.type === 'CDS') {
+  if (isCds) {
     const mRNA = feature.parent
     if (!mRNA?.children) {
       return
     }
-    const exonChildren = [...mRNA.children.values()].filter(
-      (child) => child.type === 'exon',
-    )
+    const exonChildren: AnnotationFeature[] = []
+    for (const child of mRNA.children.values()) {
+      const childIsExon = featureTypeOntology.isTypeOf(child.type, 'exon')
+      if (childIsExon) {
+        exonChildren.push(child)
+      }
+    }
+
     const overlappingExon = exonChildren.find((child) => {
       const [start, end] = intersection2(bp, bp + 1, child.min, child.max)
       return start !== undefined && end !== undefined
diff --git a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/Glyph.ts b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/Glyph.ts
index d360518de..849e8561d 100644
--- a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/Glyph.ts
+++ b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/glyphs/Glyph.ts
@@ -7,10 +7,15 @@ import {
 } from '../stateModel/mouseEvents'
 import { LinearApolloDisplayRendering } from '../stateModel/rendering'
 import { CanvasMouseEvent } from '../types'
+import { OntologyRecord } from '../../OntologyManager'
 
 export interface Glyph {
   /** @returns number of layout rows used by this glyph with this feature and zoom level */
-  getRowCount(feature: AnnotationFeature, bpPerPx: number): number
+  getRowCount(
+    feature: AnnotationFeature,
+    featureTypeOntology: OntologyRecord,
+    bpPerPx: number,
+  ): number
   /** draw the feature's primary rendering on the canvas */
   draw(
     ctx: CanvasRenderingContext2D,
@@ -24,10 +29,12 @@ export interface Glyph {
     feature: AnnotationFeature,
     bp: number,
     row: number,
+    featureTypeOntology: OntologyRecord,
   ): AnnotationFeature | undefined
   getRowForFeature(
     feature: AnnotationFeature,
     childFeature: AnnotationFeature,
+    featureTypeOntology: OntologyRecord,
   ): number | undefined
 
   drawHover(
diff --git a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/getGlyph.ts b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/getGlyph.ts
deleted file mode 100644
index a3db48a84..000000000
--- a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/getGlyph.ts
+++ /dev/null
@@ -1,40 +0,0 @@
-import { AnnotationFeature } from '@apollo-annotation/mst'
-
-import { boxGlyph, geneGlyph, genericChildGlyph } from '../glyphs'
-import { Glyph } from '../glyphs/Glyph'
-
-/** get the appropriate glyph for the given top-level feature */
-export function getGlyph(feature: AnnotationFeature): Glyph {
-  if (looksLikeGene(feature)) {
-    return geneGlyph
-  }
-  if (feature.children?.size) {
-    return genericChildGlyph
-  }
-  return boxGlyph
-}
-
-function looksLikeGene(feature: AnnotationFeature) {
-  const { children } = feature
-  if (!children?.size) {
-    return false
-  }
-  for (const [, child] of children) {
-    if (child.type === 'mRNA') {
-      const { children: grandChildren } = child
-      if (!grandChildren?.size) {
-        return false
-      }
-      const hasCDS = [...grandChildren.values()].some(
-        (grandchild) => grandchild.type === 'CDS',
-      )
-      const hasExon = [...grandChildren.values()].some(
-        (grandchild) => grandchild.type === 'exon',
-      )
-      if (hasCDS && hasExon) {
-        return true
-      }
-    }
-  }
-  return false
-}
diff --git a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/layouts.ts b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/layouts.ts
index 4e1943a76..900b37512 100644
--- a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/layouts.ts
+++ b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/layouts.ts
@@ -9,7 +9,7 @@ import { addDisposer, isAlive } from 'mobx-state-tree'
 
 import { ApolloSessionModel } from '../../session'
 import { baseModelFactory } from './base'
-import { getGlyph } from './getGlyph'
+import { boxGlyph, geneGlyph, genericChildGlyph } from '../glyphs'
 
 export function layoutsModelFactory(
   pluginManager: PluginManager,
@@ -60,6 +60,48 @@ export function layoutsModelFactory(
           return
         })
       },
+      getGlyph(feature: AnnotationFeature) {
+        if (this.looksLikeGene(feature)) {
+          return geneGlyph
+        }
+        if (feature.children?.size) {
+          return genericChildGlyph
+        }
+        return boxGlyph
+      },
+      looksLikeGene(feature: AnnotationFeature): boolean {
+        const { featureTypeOntology } =
+          self.session.apolloDataStore.ontologyManager
+        if (!featureTypeOntology) {
+          return false
+        }
+        const { children } = feature
+        if (!children?.size) {
+          return false
+        }
+        const isGene = featureTypeOntology.isTypeOf(feature.type, 'gene')
+        if (!isGene) {
+          return false
+        }
+        for (const [, child] of children) {
+          if (featureTypeOntology.isTypeOf(child.type, 'mRNA')) {
+            const { children: grandChildren } = child
+            if (!grandChildren?.size) {
+              return false
+            }
+            const hasCDS = [...grandChildren.values()].some((grandchild) =>
+              featureTypeOntology.isTypeOf(grandchild.type, 'CDS'),
+            )
+            const hasExon = [...grandChildren.values()].some((grandchild) =>
+              featureTypeOntology.isTypeOf(grandchild.type, 'exon'),
+            )
+            if (hasCDS && hasExon) {
+              return true
+            }
+          }
+        }
+        return false
+      },
     }))
     .actions((self) => ({
       addSeenFeature(feature: AnnotationFeature) {
@@ -94,10 +136,14 @@ export function layoutsModelFactory(
             ) {
               continue
             }
-            const rowCount = getGlyph(feature).getRowCount(
-              feature,
-              self.lgv.bpPerPx,
-            )
+            const { featureTypeOntology } =
+              self.session.apolloDataStore.ontologyManager
+            if (!featureTypeOntology) {
+              throw new Error('featureTypeOntology is undefined')
+            }
+            const rowCount = self
+              .getGlyph(feature)
+              .getRowCount(feature, featureTypeOntology, self.lgv.bpPerPx)
             let startingRow = 0
             let placed = false
             while (!placed) {
@@ -158,6 +204,8 @@ export function layoutsModelFactory(
       },
       getFeatureLayoutPosition(feature: AnnotationFeature) {
         const { featureLayouts } = this
+        const { featureTypeOntology } =
+          self.session.apolloDataStore.ontologyManager
         for (const [idx, layout] of featureLayouts.entries()) {
           for (const [layoutRowNum, layoutRow] of layout) {
             for (const [featureRowNum, layoutFeature] of layoutRow) {
@@ -174,10 +222,12 @@ export function layoutsModelFactory(
                 }
               }
               if (layoutFeature.hasDescendant(feature._id)) {
-                const row = getGlyph(layoutFeature).getRowForFeature(
-                  layoutFeature,
-                  feature,
-                )
+                if (!featureTypeOntology) {
+                  throw new Error('featureTypeOntology is undefined')
+                }
+                const row = self
+                  .getGlyph(layoutFeature)
+                  .getRowForFeature(layoutFeature, feature, featureTypeOntology)
                 if (row !== undefined) {
                   return {
                     layoutIndex: idx,
diff --git a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/mouseEvents.ts b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/mouseEvents.ts
index 34b649e0c..aad7a7f66 100644
--- a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/mouseEvents.ts
+++ b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/mouseEvents.ts
@@ -15,7 +15,6 @@ import type { CSSProperties } from 'react'
 import { Coord } from '../components'
 import { Glyph } from '../glyphs/Glyph'
 import { CanvasMouseEvent } from '../types'
-import { getGlyph } from './getGlyph'
 import { renderingModelFactory } from './rendering'
 import { Frame, getFrame } from '@jbrowse/core/util'
 
@@ -147,11 +146,17 @@ export function mouseEventsModelIntermediateFactory(
           return mousePosition
         }
         const [featureRow, topLevelFeature] = foundFeature
-        const glyph = getGlyph(topLevelFeature)
+        const glyph = self.getGlyph(topLevelFeature)
+        const { featureTypeOntology } =
+          self.session.apolloDataStore.ontologyManager
+        if (!featureTypeOntology) {
+          throw new Error('featureTypeOntology is undefined')
+        }
         const feature = glyph.getFeatureFromLayout(
           topLevelFeature,
           bp,
           featureRow,
+          featureTypeOntology,
         )
         if (!feature) {
           return mousePosition
@@ -227,15 +232,27 @@ export function mouseEventsSeqHightlightModelFactory(
               self.lgv.bpPerPx <= 1 ? 125 : 95,
             )
 
-            const { apolloHover, lgv, regions, sequenceRowHeight, theme } = self
+            const {
+              apolloHover,
+              lgv,
+              regions,
+              sequenceRowHeight,
+              session,
+              theme,
+            } = self
 
             if (!apolloHover) {
               return
             }
             const { feature } = apolloHover
 
+            const { featureTypeOntology } =
+              session.apolloDataStore.ontologyManager
+            if (!featureTypeOntology) {
+              throw new Error('featureTypeOntology is undefined')
+            }
             for (const [idx, region] of regions.entries()) {
-              if (feature.type === 'CDS') {
+              if (featureTypeOntology.isTypeOf(feature.type, 'CDS')) {
                 const parentFeature = feature.parent
                 if (!parentFeature) {
                   continue
@@ -323,7 +340,7 @@ export function mouseEventsModelFactory(
         return []
       }
       const { topLevelFeature } = apolloHover
-      const glyph = getGlyph(topLevelFeature)
+      const glyph = self.getGlyph(topLevelFeature)
       return glyph.getContextMenuItems(self)
     },
   }))
@@ -483,7 +500,9 @@ export function mouseEventsModelFactory(
               if (apolloDragging) {
                 // NOTE: the glyph where the drag started is responsible for drawing the preview.
                 // it can call methods in other glyphs to help with this though.
-                const glyph = getGlyph(apolloDragging.feature.topLevelFeature)
+                const glyph = self.getGlyph(
+                  apolloDragging.feature.topLevelFeature,
+                )
                 glyph.drawDragPreview(self, ctx)
               }
             },
diff --git a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/rendering.ts b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/rendering.ts
index 35cb0b322..67d2e9985 100644
--- a/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/rendering.ts
+++ b/packages/jbrowse-plugin-apollo/src/LinearApolloDisplay/stateModel/rendering.ts
@@ -7,7 +7,6 @@ import { autorun } from 'mobx'
 import { Instance, addDisposer } from 'mobx-state-tree'
 
 import { ApolloSessionModel } from '../../session'
-import { getGlyph } from './getGlyph'
 import { layoutsModelFactory } from './layouts'
 
 export function renderingModelIntermediateFactory(
@@ -428,7 +427,7 @@ export function renderingModelFactory(
                   ) {
                     continue
                   }
-                  getGlyph(feature).draw(ctx, feature, row, self, idx)
+                  self.getGlyph(feature).draw(ctx, feature, row, self, idx)
                 }
               }
             }
diff --git a/packages/jbrowse-plugin-apollo/src/OntologyManager/index.ts b/packages/jbrowse-plugin-apollo/src/OntologyManager/index.ts
index 3225c522f..116dc1582 100644
--- a/packages/jbrowse-plugin-apollo/src/OntologyManager/index.ts
+++ b/packages/jbrowse-plugin-apollo/src/OntologyManager/index.ts
@@ -5,7 +5,13 @@ import {
   UriLocation,
 } from '@jbrowse/core/util/types/mst'
 import { autorun } from 'mobx'
-import { Instance, addDisposer, getSnapshot, types } from 'mobx-state-tree'
+import {
+  Instance,
+  addDisposer,
+  flow,
+  getSnapshot,
+  types,
+} from 'mobx-state-tree'
 
 import OntologyStore, { OntologyStoreOptions } from './OntologyStore'
 import { OntologyDBNode } from './OntologyStore/indexeddb-schema'
@@ -19,6 +25,7 @@ export const OntologyRecordType = types
     version: 'unversioned',
     source: types.union(LocalPathLocation, UriLocation, BlobLocation),
     options: types.frozen<OntologyStoreOptions>(),
+    equivalentTypes: types.map(types.array(types.string)),
   })
   .volatile((_self) => ({
     dataStore: undefined as undefined | OntologyStore,
@@ -44,6 +51,42 @@ export const OntologyRecordType = types
         }),
       )
     },
+    setEquivalentTypes(type: string, equivalentTypes: string[]) {
+      self.equivalentTypes.set(type, equivalentTypes)
+    },
+  }))
+  .actions((self) => ({
+    loadEquivalentTypes: flow(function* loadEquivalentTypes(type: string) {
+      if (!self.dataStore) {
+        return
+      }
+      const terms = (yield self.dataStore.getTermsWithLabelOrSynonym(
+        type,
+      )) as unknown as OntologyTerm[]
+      const equivalents: string[] = terms
+        .map((term) => term.lbl)
+        .filter((term) => term != undefined)
+      self.setEquivalentTypes(type, equivalents)
+    }),
+  }))
+  .views((self) => ({
+    isTypeOf(queryType: string, typeOf: string): boolean {
+      if (queryType === typeOf) {
+        return true
+      }
+      if (!self.dataStore) {
+        return false
+      }
+      const equivalents = self.equivalentTypes.get(typeOf)
+      if (!equivalents) {
+        void self.loadEquivalentTypes(typeOf)
+        return false
+      }
+      if (equivalents.includes(queryType)) {
+        return true
+      }
+      return false
+    },
   }))
 
 export const OntologyManagerType = types
diff --git a/packages/jbrowse-plugin-apollo/src/SixFrameFeatureDisplay/stateModel.ts b/packages/jbrowse-plugin-apollo/src/SixFrameFeatureDisplay/stateModel.ts
index 41c2dad84..7e29842ee 100644
--- a/packages/jbrowse-plugin-apollo/src/SixFrameFeatureDisplay/stateModel.ts
+++ b/packages/jbrowse-plugin-apollo/src/SixFrameFeatureDisplay/stateModel.ts
@@ -270,6 +270,11 @@ export function stateModelFactory(
         return codonLayout
       },
       get featureLayout() {
+        const { featureTypeOntology } =
+          self.session.apolloDataStore.ontologyManager
+        if (!featureTypeOntology) {
+          throw new Error('featureTypeOntology is undefined')
+        }
         const featureLayout = new Map<number, [string, AnnotationFeature][]>()
         for (const [refSeq, featuresForRefSeq] of this.features || []) {
           if (!featuresForRefSeq) {
@@ -295,11 +300,13 @@ export function stateModelFactory(
             },
           )) {
             for (const [, childFeature] of feature.children ?? new Map()) {
-              if (childFeature.type === 'mRNA') {
+              if (featureTypeOntology.isTypeOf(childFeature.type, 'mRNA')) {
                 for (const [, grandChildFeature] of childFeature.children ||
                   new Map()) {
                   let startingRow
-                  if (grandChildFeature.type === 'CDS') {
+                  if (
+                    featureTypeOntology.isTypeOf(grandChildFeature.type, 'CDS')
+                  ) {
                     let discontinuousLocations
                     if (grandChildFeature.discontinuousLocations.length > 0) {
                       ;({ discontinuousLocations } = grandChildFeature)
diff --git a/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/Feature.tsx b/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/Feature.tsx
index 3e2efdd29..6b45b55b8 100644
--- a/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/Feature.tsx
+++ b/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/Feature.tsx
@@ -21,7 +21,6 @@ import { FeatureAttributes } from './FeatureAttributes'
 import { featureContextMenuItems } from './featureContextMenuItems'
 import type { ContextMenuState } from './HybridGrid'
 import { NumberCell } from './NumberCell'
-import { getGlyph } from '../../LinearApolloDisplay/stateModel/getGlyph'
 
 const useStyles = makeStyles()((theme) => ({
   typeContent: {
@@ -134,7 +133,7 @@ export const Feature = observer(function Feature({
           displayState.setApolloHover({
             feature,
             topLevelFeature: getTopLevelFeature(feature),
-            glyph: getGlyph(getTopLevelFeature(feature)),
+            glyph: displayState.getGlyph(getTopLevelFeature(feature)),
           })
         }}
         className={
diff --git a/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/featureContextMenuItems.ts b/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/featureContextMenuItems.ts
index 061bde146..774d92eaf 100644
--- a/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/featureContextMenuItems.ts
+++ b/packages/jbrowse-plugin-apollo/src/TabularEditor/HybridGrid/featureContextMenuItems.ts
@@ -137,7 +137,14 @@ export function featureContextMenuItems(
         },
       },
     )
-    if (feature.type === 'mRNA' && isSessionModelWithWidgets(session)) {
+    const { featureTypeOntology } = session.apolloDataStore.ontologyManager
+    if (!featureTypeOntology) {
+      throw new Error('featureTypeOntology is undefined')
+    }
+    if (
+      featureTypeOntology.isTypeOf(feature.type, 'mRNA') &&
+      isSessionModelWithWidgets(session)
+    ) {
       menuItems.push({
         label: 'Edit transcript details',
         onClick: () => {
diff --git a/packages/jbrowse-plugin-apollo/test_data/so_types.gff3 b/packages/jbrowse-plugin-apollo/test_data/so_types.gff3
new file mode 100644
index 000000000..e5a1348a1
--- /dev/null
+++ b/packages/jbrowse-plugin-apollo/test_data/so_types.gff3
@@ -0,0 +1,28 @@
+##gff-version 3
+chr1	VEuPathDB	protein_coding_gene	1	200	.	-	.	ID=TGGT1_200010
+chr1	VEuPathDB	mRNA_with_frameshift	1	200	.	-	.	ID=TGGT1_200010-t26_1;Parent=TGGT1_200010
+chr1	VEuPathDB	interior_exon	1	50	.	-	.	ID=exon_TGGT1_200010-t26_1-E2;Parent=TGGT1_200010-t26_1
+chr1	VEuPathDB	interior_exon	70	100	.	-	.	ID=exon_TGGT1_200010-t26_1-E1;Parent=TGGT1_200010-t26_1
+chr1	VEuPathDB	CDS	1	50	.	-	1	ID=TGGT1_200010-t26_1-p1-CDS2;Parent=TGGT1_200010-t26_1
+chr1	VEuPathDB	CDS	70	100	.	-	0	ID=TGGT1_200010-t26_1-p1-CDS1;Parent=TGGT1_200010-t26_1
+##FASTA
+>chr1
+cattgttgcggagttgaacaacggcattacgaacacttccgtctctcacttttatacgat
+tatgattggttctttacccttggtttacattggtactagtagcggcgctaatgctacctg
+aattgagaactcgagcgggggctaggcaaattctgattcagcctgacttctcttggaacc
+ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca
+acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag
+atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac
+gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc
+aggctactttgaaagagcgcagaatacttagacggtatcgatcatggtagcatagcattc
+tgataacatgtatggagttcgaacatccgtctggggccggacggtccgtttgaggttggt
+tgatctgggtgatagtcagcaagatagacgttagataacaaattaaaggattttacctta
+gattgcgactagtacaacggtacatcggtgattcgcgctctactagatcacgctatgggt
+accataaacaaacggtggaccttctcaagctggttgacgcctcagcaacataggcttcct
+cctccacgcatctcagcataaaaggcttataaactgcttctttgtgccagagcaactcaa
+ttaagcccttggtaccgtgggcacgcattctgtcacggtgaccaactgttcatcctgaat
+cgccgaatgggactatttggtacaggaatcaagcggatggcactactgcagcttatttac
+gacggtattcttaaagtttttaagacaatgtatttcatgggtagttcggtttgttttatt
+gctacacaggctcttgtagacgacctacttagcactacggccgagcgcaataacccccgg
+aaagcacttgctactgggaggcgggtttatccatcggcaataggggttatcagtactacc
+aagaagattgtgaagatattaacagcattgaaaaaagttcggactgggcatgaaacgtgt